its all there, just work for it [clothes +]

Jump to Last Post 1-2 of 2 discussions (6 posts)
  1. Danie Van Gilder profile image41
    Danie Van Gilderposted 13 years ago

    we have to work to make our clothing, homes and food,  such IS stored in nature as: sheep, cotton, then rocks and stones and wood, and vegetables.  tehy are all there, we just need to go out there and harvest them, work to get them, like:
             sewing    wool cotton
             homes     rocks and trees
             food      vegetabels and fruit and nuts
        this proves there is a God, for he planned it to be that way.  then gasoline from oil and some say, too,:
           marrijuanna and peyote and mushrooms?  like beer and wine inclueded too?

    1. profile image0
      Home Girlposted 13 years agoin reply to this

      Did he tell you personally about his plans?

    2. Stimp profile image60
      Stimpposted 13 years agoin reply to this

      Okay....I think we already do this?  What's your point.

    3. Disappearinghead profile image61
      Disappearingheadposted 13 years agoin reply to this

      God gave us beer and wine because He wantd us to b happy. smile

  2. I am DB Cooper profile image64
    I am DB Cooperposted 13 years ago

    Hmmm, I'm not too sure this is a proof of God. If people evolved from simpler living organisms that evolved from self-replicating semi-permeable membranes that were created through a spontaneous chemical process we also get our current world filled with a variety of species and it's all done without a creator. The theory of evolution makes it nearly impossible for humans to exist without the existence of other living species. That's just how evolution works. A change in a subset of a species that can be passed down from generation to generation does not need to kill off the original species, especially if they have been separated and are in different ecosystems. Species evolve based on their environment. Whatever changes that help them be more sexually productive are the changes that survive. We would have never been able to evolve into humans if the animals we evolved from did not have edible food. That doesn't necessarily mean that there was a God creating this food for us.

    1. Danie Van Gilder profile image41
      Danie Van Gilderposted 13 years agoin reply to this

      have you known that by ONLY, usualy, three different chemicals make up all life forms?  (Carbon, Hydrogen and Oxygen) and that only, mostly three (four too?) DNA type chemicals make up all the different personalities of man, just out of three chemicals, all of life is from by, so that that was started somehow, liike a game of pool, with balls and sticks, so that, so many different games could actually play, one started wioth only three chemicals and three dna strands, and got billions of different life from thadt only three different chemicals.
          so, in meaning = on different planets, they would use more different chemicals!  than ours.  c h o  and   t a g c   so that by those only, all of OUR life is made from, generaly very simple..  how many combinations of, say, three letters can you come up with?   choo ohcc hhhoochoo coo hoc c????  well, that's life (yours?) simple, very very...  i guess you were smarter than others, eh?     ttattggaattaaggataggttatagga??? that's your left wallet the bank took from you to make more from/by your money!!!

 
working

This website uses cookies

As a user in the EEA, your approval is needed on a few things. To provide a better website experience, hubpages.com uses cookies (and other similar technologies) and may collect, process, and share personal data. Please choose which areas of our service you consent to our doing so.

For more information on managing or withdrawing consents and how we handle data, visit our Privacy Policy at: https://corp.maven.io/privacy-policy

Show Details
Necessary
HubPages Device IDThis is used to identify particular browsers or devices when the access the service, and is used for security reasons.
LoginThis is necessary to sign in to the HubPages Service.
Google RecaptchaThis is used to prevent bots and spam. (Privacy Policy)
AkismetThis is used to detect comment spam. (Privacy Policy)
HubPages Google AnalyticsThis is used to provide data on traffic to our website, all personally identifyable data is anonymized. (Privacy Policy)
HubPages Traffic PixelThis is used to collect data on traffic to articles and other pages on our site. Unless you are signed in to a HubPages account, all personally identifiable information is anonymized.
Amazon Web ServicesThis is a cloud services platform that we used to host our service. (Privacy Policy)
CloudflareThis is a cloud CDN service that we use to efficiently deliver files required for our service to operate such as javascript, cascading style sheets, images, and videos. (Privacy Policy)
Google Hosted LibrariesJavascript software libraries such as jQuery are loaded at endpoints on the googleapis.com or gstatic.com domains, for performance and efficiency reasons. (Privacy Policy)
Features
Google Custom SearchThis is feature allows you to search the site. (Privacy Policy)
Google MapsSome articles have Google Maps embedded in them. (Privacy Policy)
Google ChartsThis is used to display charts and graphs on articles and the author center. (Privacy Policy)
Google AdSense Host APIThis service allows you to sign up for or associate a Google AdSense account with HubPages, so that you can earn money from ads on your articles. No data is shared unless you engage with this feature. (Privacy Policy)
Google YouTubeSome articles have YouTube videos embedded in them. (Privacy Policy)
VimeoSome articles have Vimeo videos embedded in them. (Privacy Policy)
PaypalThis is used for a registered author who enrolls in the HubPages Earnings program and requests to be paid via PayPal. No data is shared with Paypal unless you engage with this feature. (Privacy Policy)
Facebook LoginYou can use this to streamline signing up for, or signing in to your Hubpages account. No data is shared with Facebook unless you engage with this feature. (Privacy Policy)
MavenThis supports the Maven widget and search functionality. (Privacy Policy)
Marketing
Google AdSenseThis is an ad network. (Privacy Policy)
Google DoubleClickGoogle provides ad serving technology and runs an ad network. (Privacy Policy)
Index ExchangeThis is an ad network. (Privacy Policy)
SovrnThis is an ad network. (Privacy Policy)
Facebook AdsThis is an ad network. (Privacy Policy)
Amazon Unified Ad MarketplaceThis is an ad network. (Privacy Policy)
AppNexusThis is an ad network. (Privacy Policy)
OpenxThis is an ad network. (Privacy Policy)
Rubicon ProjectThis is an ad network. (Privacy Policy)
TripleLiftThis is an ad network. (Privacy Policy)
Say MediaWe partner with Say Media to deliver ad campaigns on our sites. (Privacy Policy)
Remarketing PixelsWe may use remarketing pixels from advertising networks such as Google AdWords, Bing Ads, and Facebook in order to advertise the HubPages Service to people that have visited our sites.
Conversion Tracking PixelsWe may use conversion tracking pixels from advertising networks such as Google AdWords, Bing Ads, and Facebook in order to identify when an advertisement has successfully resulted in the desired action, such as signing up for the HubPages Service or publishing an article on the HubPages Service.
Statistics
Author Google AnalyticsThis is used to provide traffic data and reports to the authors of articles on the HubPages Service. (Privacy Policy)
ComscoreComScore is a media measurement and analytics company providing marketing data and analytics to enterprises, media and advertising agencies, and publishers. Non-consent will result in ComScore only processing obfuscated personal data. (Privacy Policy)
Amazon Tracking PixelSome articles display amazon products as part of the Amazon Affiliate program, this pixel provides traffic statistics for those products (Privacy Policy)
ClickscoThis is a data management platform studying reader behavior (Privacy Policy)