we have to work to make our clothing, homes and food, such IS stored in nature as: sheep, cotton, then rocks and stones and wood, and vegetables. tehy are all there, we just need to go out there and harvest them, work to get them, like:
sewing wool cotton
homes rocks and trees
food vegetabels and fruit and nuts
this proves there is a God, for he planned it to be that way. then gasoline from oil and some say, too,:
marrijuanna and peyote and mushrooms? like beer and wine inclueded too?
Okay....I think we already do this? What's your point.
God gave us beer and wine because He wantd us to b happy.
Hmmm, I'm not too sure this is a proof of God. If people evolved from simpler living organisms that evolved from self-replicating semi-permeable membranes that were created through a spontaneous chemical process we also get our current world filled with a variety of species and it's all done without a creator. The theory of evolution makes it nearly impossible for humans to exist without the existence of other living species. That's just how evolution works. A change in a subset of a species that can be passed down from generation to generation does not need to kill off the original species, especially if they have been separated and are in different ecosystems. Species evolve based on their environment. Whatever changes that help them be more sexually productive are the changes that survive. We would have never been able to evolve into humans if the animals we evolved from did not have edible food. That doesn't necessarily mean that there was a God creating this food for us.
have you known that by ONLY, usualy, three different chemicals make up all life forms? (Carbon, Hydrogen and Oxygen) and that only, mostly three (four too?) DNA type chemicals make up all the different personalities of man, just out of three chemicals, all of life is from by, so that that was started somehow, liike a game of pool, with balls and sticks, so that, so many different games could actually play, one started wioth only three chemicals and three dna strands, and got billions of different life from thadt only three different chemicals.
so, in meaning = on different planets, they would use more different chemicals! than ours. c h o and t a g c so that by those only, all of OUR life is made from, generaly very simple.. how many combinations of, say, three letters can you come up with? choo ohcc hhhoochoo coo hoc c???? well, that's life (yours?) simple, very very... i guess you were smarter than others, eh? ttattggaattaaggataggttatagga??? that's your left wallet the bank took from you to make more from/by your money!!!
by G. Diane Nelson Trotter 10 years ago
If humans evolved from fish or chimpanzees, why are there still fish and chimpanzees?Many scientists agree that man evolved from fish or chimpanzees. If that is the case, why are there still fish and chimpanzees. Why are there not stages of evolution going on now? There may be a...
by Freegoldman 12 years ago
is there a logic..
by Tie Baker 6 years ago
What does love mean to the new generation?In todays world does love still exit
by Baileybear 13 years ago
Or do they find it too much of a threat to their beliefs?
by CMHypno 13 years ago
Major DNA study shows that our ancestors could have interbred with Neanderthal populations at least twice in our history and that most humans carry some Neanderthal geneshttp://www.dailymail.co.uk/sciencetech/ … tists.html
by pisean282311 13 years ago
do you believe in adam/eve story or consider it symbolic?
Copyright © 2024 The Arena Media Brands, LLC and respective content providers on this website. HubPages® is a registered trademark of The Arena Platform, Inc. Other product and company names shown may be trademarks of their respective owners. The Arena Media Brands, LLC and respective content providers to this website may receive compensation for some links to products and services on this website.
Copyright © 2024 Maven Media Brands, LLC and respective owners.
As a user in the EEA, your approval is needed on a few things. To provide a better website experience, hubpages.com uses cookies (and other similar technologies) and may collect, process, and share personal data. Please choose which areas of our service you consent to our doing so.
For more information on managing or withdrawing consents and how we handle data, visit our Privacy Policy at: https://corp.maven.io/privacy-policy
Show DetailsNecessary | |
---|---|
HubPages Device ID | This is used to identify particular browsers or devices when the access the service, and is used for security reasons. |
Login | This is necessary to sign in to the HubPages Service. |
Google Recaptcha | This is used to prevent bots and spam. (Privacy Policy) |
Akismet | This is used to detect comment spam. (Privacy Policy) |
HubPages Google Analytics | This is used to provide data on traffic to our website, all personally identifyable data is anonymized. (Privacy Policy) |
HubPages Traffic Pixel | This is used to collect data on traffic to articles and other pages on our site. Unless you are signed in to a HubPages account, all personally identifiable information is anonymized. |
Amazon Web Services | This is a cloud services platform that we used to host our service. (Privacy Policy) |
Cloudflare | This is a cloud CDN service that we use to efficiently deliver files required for our service to operate such as javascript, cascading style sheets, images, and videos. (Privacy Policy) |
Google Hosted Libraries | Javascript software libraries such as jQuery are loaded at endpoints on the googleapis.com or gstatic.com domains, for performance and efficiency reasons. (Privacy Policy) |
Features | |
---|---|
Google Custom Search | This is feature allows you to search the site. (Privacy Policy) |
Google Maps | Some articles have Google Maps embedded in them. (Privacy Policy) |
Google Charts | This is used to display charts and graphs on articles and the author center. (Privacy Policy) |
Google AdSense Host API | This service allows you to sign up for or associate a Google AdSense account with HubPages, so that you can earn money from ads on your articles. No data is shared unless you engage with this feature. (Privacy Policy) |
Google YouTube | Some articles have YouTube videos embedded in them. (Privacy Policy) |
Vimeo | Some articles have Vimeo videos embedded in them. (Privacy Policy) |
Paypal | This is used for a registered author who enrolls in the HubPages Earnings program and requests to be paid via PayPal. No data is shared with Paypal unless you engage with this feature. (Privacy Policy) |
Facebook Login | You can use this to streamline signing up for, or signing in to your Hubpages account. No data is shared with Facebook unless you engage with this feature. (Privacy Policy) |
Maven | This supports the Maven widget and search functionality. (Privacy Policy) |
Marketing | |
---|---|
Google AdSense | This is an ad network. (Privacy Policy) |
Google DoubleClick | Google provides ad serving technology and runs an ad network. (Privacy Policy) |
Index Exchange | This is an ad network. (Privacy Policy) |
Sovrn | This is an ad network. (Privacy Policy) |
Facebook Ads | This is an ad network. (Privacy Policy) |
Amazon Unified Ad Marketplace | This is an ad network. (Privacy Policy) |
AppNexus | This is an ad network. (Privacy Policy) |
Openx | This is an ad network. (Privacy Policy) |
Rubicon Project | This is an ad network. (Privacy Policy) |
TripleLift | This is an ad network. (Privacy Policy) |
Say Media | We partner with Say Media to deliver ad campaigns on our sites. (Privacy Policy) |
Remarketing Pixels | We may use remarketing pixels from advertising networks such as Google AdWords, Bing Ads, and Facebook in order to advertise the HubPages Service to people that have visited our sites. |
Conversion Tracking Pixels | We may use conversion tracking pixels from advertising networks such as Google AdWords, Bing Ads, and Facebook in order to identify when an advertisement has successfully resulted in the desired action, such as signing up for the HubPages Service or publishing an article on the HubPages Service. |
Statistics | |
---|---|
Author Google Analytics | This is used to provide traffic data and reports to the authors of articles on the HubPages Service. (Privacy Policy) |
Comscore | ComScore is a media measurement and analytics company providing marketing data and analytics to enterprises, media and advertising agencies, and publishers. Non-consent will result in ComScore only processing obfuscated personal data. (Privacy Policy) |
Amazon Tracking Pixel | Some articles display amazon products as part of the Amazon Affiliate program, this pixel provides traffic statistics for those products (Privacy Policy) |
Clicksco | This is a data management platform studying reader behavior (Privacy Policy) |