ArtsAutosBooksBusinessEducationEntertainmentFamilyFashionFoodGamesGenderHealthHolidaysHomeHubPagesPersonal FinancePetsPoliticsReligionSportsTechnologyTravel
  • »
  • Education and Science»
  • Life Sciences

Cellular Mutations - How They Occur - Mutations in The DNA Molecule

Updated on April 25, 2012
Source

Mutations within cells

Quick Explanation of a DNA molecule

There are ‘four’ different nucleotides within a molecule of DNA called Thymine, Adenine, Cytosine and Guanine. A nucleotide is sort of like a small block in the assembly of a DNA molecule. A DNA molecule has a pattern and a few rules in which each nucleotide will correctly pair with each other called ‘base pairing’. Thymine and Adenine pair together and Cytosine and Guanine pair together. The order in which these base pairs are within the DNA molecule is known as a DNA sequence. A DNA sequence is read in blocks of three base pairs known as a codon therefore as DNA is being read three nucleotides are being read at a time. Mutations occur when a nucleotide is changed/deleted etc.

In simple terms a protein is made up of Amino Acids. When a DNA molecule is read each codon will translate to an Amino acid therefore it is crucial that the order of nucleotides is correct. To make it a little more complicated an amino acid can have more than one codon. A change in any the DNA sequence may change which amino acid is made and therefore a completely different protein which may not function properly, leading to disease.

For example AGG would code for the protein Arginine. Figure one is a table to explain the different codons and to which amino acid they translate to.

A = Adenine
T = Thymine
C = Cytosine
G = Guanine

·Example DNA sequence
ATGTAATATAGCGATCGCGCG

·This would be read as
ATG/TAA/TAT/AGC/GAT/CGC/GCG

· An example codon would be AGG

Source

What is a mutation?

  • Permanent change in DNA sequence
  • Function change in gene product (malfunctioning protein)
  • Gene product is usually a protein

The consequences of Mutations!

Germ Cells
Mutations occurring in the germ cells (gametes i.e. Sperm and Egg cells) are heritable, and may lead to a genetic disease in the offspring!

For example Hypertrichosis

Somatic/Body Cells
Mutations occurring in somatic body cells are not inherited by the offspring because the mutations occur in body cells and not in germ cells. Mutations interfere with normal cell functions such as the cell cycle.

Defence against Tumour Formation

  • Cell Death - Accumulation of mutations contributed to cell senescence or death (apoptosis). A mutation in a single gene may be sufficient to induce cell death (apoptosis). Mutation is not passed on.
  • DNA repair systems detect and repair the damage to that cell: mutation is not passed on to daughter cells
  • The cell cannot function and dies: mutation is not passed on

The facts that you may have to read a few times because it’s that surprising!

Mutation rate

1 in 30 million nucleotides!
According to the human genome project there are 3164.7million Base Pairs per human genome
Therefore: 105 base changes per cell division!
Now imagine how many cells are within the human body and how much change that is!

Although!! <2% of genome codes for protein (approx. 63 million nucleotides)
Therefore: approx 2 coding base changes per cell division!
It can be said that every time a cell divides mutations occur. Defences against mutations and the severity of the change is what may or may not cause disease because silent polymorphisms can occur (silent polymorphisms explained in another article).

Many of these changes may be silent! (Silent mutations will be explained in another article)

Mutation during gametogensis (Sperm and Egg cells)

To produce an ovum (Egg)
The amount of divisions that occur in Egg cells is very small, only 24 divisions therefore 105 base changes per cell division multiplied by 24 divisions = 2520 random base changes
Only 2 coding changes per cell division due to only <2% human genome codes for proteins.
THIS ALL MEANS! Only 48 random protein coding changes in an Egg cell

To produce a sperm
A sperm cell is constantly dividing unlike an egg cell and therefore the amount of mutations that can occurs is much larger.
A 28 year old male would have had around 334 divisions. Therefore 105 x 334 = 35,070 random base changes!
2 x 334 = 668 RANDOM CODING CHANGES! In a Sperm cell
A 35 year old male would have around 495 divisions therefore 105 x495 = 51,975 random base changes!
2 x 495 = 990 RANDOM CODING CHANGES! In a Sperm cell

The male gamete sperm has a much higher rate of mutation compared to the egg cell and the older a male becomes the higher the chance of mutation.


Source

This final image is just to show what I have been talking about.
DNA is transcribed into mRNA and mRNA is translated to Protein. A change in the DNA sequence will change the final outcome, a protein. Any change that occurs to a protein may result in a disease as proteins are essential for almost everything in the body.

A very brief introduction on how mutations occur! Only part one of many! Keep posted!

If you find my Hub interesting don't hesitate in leaving a comment, I would really appreciate it.


Thanks

Mike

Did this Hub help you understand genetic mutations?

See results

Comments

    0 of 8192 characters used
    Post Comment

    No comments yet.

    working

    This website uses cookies

    As a user in the EEA, your approval is needed on a few things. To provide a better website experience, hubpages.com uses cookies (and other similar technologies) and may collect, process, and share personal data. Please choose which areas of our service you consent to our doing so.

    For more information on managing or withdrawing consents and how we handle data, visit our Privacy Policy at: "https://hubpages.com/privacy-policy#gdpr"

    Show Details
    Necessary
    HubPages Device IDThis is used to identify particular browsers or devices when the access the service, and is used for security reasons.
    LoginThis is necessary to sign in to the HubPages Service.
    Google RecaptchaThis is used to prevent bots and spam. (Privacy Policy)
    AkismetThis is used to detect comment spam. (Privacy Policy)
    HubPages Google AnalyticsThis is used to provide data on traffic to our website, all personally identifyable data is anonymized. (Privacy Policy)
    HubPages Traffic PixelThis is used to collect data on traffic to articles and other pages on our site. Unless you are signed in to a HubPages account, all personally identifiable information is anonymized.
    Amazon Web ServicesThis is used to collect data on traffic to articles and other pages on our site. Unless you are signed in to a HubPages account, all personally identifiable information is anonymized. (Privacy Policy)
    CloudflareThis is used to quickly and efficiently deliver files such as javascript, cascading style sheets, images, and videos. (Privacy Policy)
    Google Hosted LibrariesJavascript software libraries such as jQuery are loaded at endpoints on the googleapis.com or gstatic.com domains, for performance and efficiency reasons. (Privacy Policy)
    Facebook LoginYou can use this to streamline signing up for, or signing in to your Hubpages account. No data is shared with Facebook unless you engage with this feature. (Privacy Policy)
    PaypalThis is used for a registered author who enrolls in the HubPages Earnings program and requests to be paid via PayPal. No data is shared with Paypal unless you engage with this feature. (Privacy Policy)
    Google AdSense Host APIThis service allows you to sign up for or associate a Google AdSense account with HubPages, so that you can earn money from ads on your articles. No data is shared unless you engage with this feature. (Privacy Policy)
    Features
    Google Custom SearchThis is feature allows you to search the site. (Privacy Policy)
    Google MapsSome articles have Google Maps embedded in them. (Privacy Policy)
    Google ChartsThis is used to display charts and graphs on articles and the author center. (Privacy Policy)
    Google YouTubeSome articles have YouTube videos embedded in them. (Privacy Policy)
    VimeoSome articles have Vimeo videos embedded in them. (Privacy Policy)
    MavenThis supports the Maven widget and search functionality. (Privacy Policy)
    Marketing
    Google AdSenseThis is an ad network. (Privacy Policy)
    Google DoubleClickGoogle provides ad serving technology and runs an ad network. (Privacy Policy)
    Index ExchangeThis is an ad network. (Privacy Policy)
    SovrnThis is an ad network. (Privacy Policy)
    Facebook AdsThis is an ad network. (Privacy Policy)
    Amazon Unified Ad MarketplaceThis is an ad network. (Privacy Policy)
    AppNexusThis is an ad network. (Privacy Policy)
    OpenxThis is an ad network. (Privacy Policy)
    Rubicon ProjectThis is an ad network. (Privacy Policy)
    TripleLiftThis is an ad network. (Privacy Policy)
    Say MediaWe partner with Say Media to deliver ad campaigns on our sites. (Privacy Policy)
    Remarketing PixelsWe may use remarketing pixels from advertising networks such as Google AdWords, Bing Ads, and Facebook in order to advertise the HubPages Service to people that have visited our sites.
    Conversion Tracking PixelsWe may use conversion tracking pixels from advertising networks such as Google AdWords, Bing Ads, and Facebook in order to identify when an advertisements has successfully resulted in the desired action, such as signing up for the HubPages Service or publishing an article on the HubPages Service.
    Statistics
    Author Google AnalyticsThis is used to provide traffic data and reports to the authors of articles on the HubPages Service. (Privacy Policy)
    ComscoreComScore is a media measurement and analytics company providing marketing data and analytics to enterprises, media and advertising agencies, and publishers. Non-consent will result in ComScore only processing obfuscated personal data. (Privacy Policy)
    Amazon Tracking PixelSome articles display amazon products as part of the Amazon Affiliate program, this pixel provides traffic statistics for those products (Privacy Policy)