ArtsAutosBooksBusinessEducationEntertainmentFamilyFashionFoodGamesGenderHealthHolidaysHomeHubPagesPersonal FinancePetsPoliticsReligionSportsTechnologyTravel
  • »
  • Religion and Philosophy»
  • Atheism & Agnosticism

The Unknown Argument - The Fundamental Issue with a Great Creator

Updated on June 13, 2012
How did all this come to be?  What would an almighty world creator be doing caring about such an insignificant part of his universe as Earth?
How did all this come to be? What would an almighty world creator be doing caring about such an insignificant part of his universe as Earth? | Source

Essentially, we have two terrible theories for how we were created.

  1. In one, we were not created by any God, we spurred out of nothing (or as part of an infinite loop). We don't know how our existence out of nothing came into being.
  2. In the other, we were created by God(s), explaining how we came to be. However, no explanation of how the God(s) were created are known. No explanation of how they created matter out of nothing is known either.

The argument therefore is, because in both cases we essentially do not know how something came to being, a logical person would choose to believe that the less complicated theory, which is based on something that has less questions to it, is the more likely theory.

  1. With the first, less complicated theory, we do not know how matter came into being.
  2. With the second theory, we do not know how A) an entity capable of creating matter came into being AS WELL AS B) how this being created matter out of nothing, in other words - the exact same question as in the first theory plus a much bigger one.

Why then, would anyone choose the latter over the former?

I personally would see it as acceptable to say "both are not strong arguments" or "the first argument is stronger because it has less questions to it" but at no point is it rational to state that "the second theory has more answerless questions to it and so it has to be better than the first argument."

This is not at all considering of course, complexities such as how an entity with a personality that cares for what we on Earth (a minuscule part of the galaxy) do with our lives. That would open up even more questions because explaining how a being came to be with the power to create the universe is one thing, but explaining how and why he has a personality that specifically disagrees with homosexuality or abortion is another. Why would such an almighty being even care?


It looks like we are all alone on our beautiful planet. Would you want it any other way?
It looks like we are all alone on our beautiful planet. Would you want it any other way? | Source

To Sum Up

We either have "mass was created out of nothing" which is illogical or "a being was created out of nothing [illogical] and somehow had the ability [illogical] to create mass out of nothing [illogical]" (and then have the ability to watch over you [illogical], judge you [illogical] and punish you [illogical] in a personal God).

Why then would you personally argue that there is a creator, or any more evidence for there being one than there not being one?

Do you understand this argument?

See results

Do you agree with it?

See results

Comments

    0 of 8192 characters used
    Post Comment

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      ("And yes, I create new definitions or even new words when the old doesn't work. That's called progress. Science does it all the time. Our culture does it, too. The language evolves. Some people resist this, because they want to hold onto the old ways. And that's okay, but then they have a hard time understanding new things.)

      This is very messed up Lone77Star. You don't just change definitions of words by yourself. You need a consensus. It's not progress, it's lunacy. No one resists language evolution but everyone is given awareness of new definitions of words via those things called dictionaries, the standard that we refer to.

      How can you call changing definitions of words to your own benefit "progress"? I think what It would actually be is "chaos" because any time you make an argument, I'll just change the definitions of all of your words so that you sound like a megalomaniac or murderer.

      For example: I've just decided to argue that you are a murderer!

      I have also just now decided to change the definitions of your following words:

      Some- All

      People- Organisms

      Resist- Must

      This- Die

      To me you just said "all people must die", that's ATROCIOUS Lone77star!! How could you do such a thing!?!?!

      Stupid you say? Childish it was?

      Well it was no different from you saying: I have just decided to argue that God is omniscient.

      I have also just decided to change the definition of the following words:

      Omniscient- Partially knowing, knowing only the present and the past, and some of the future.

      Lunacy. Not progress. Lunacy.

      Evolution of language happens in many ways, but not by one man deciding that the definition of words need to be changed to protect God's credibility.

      No, God was described as being omniscient, using the dictionary definition of omniscient. It is not acceptable to say "yeah but now the word means something else" because the word when used to describe God had an original meaning, that must be adhered to for all intents and purposes of argument.

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      "So, 165 of the 255 stable nuclides are "theoretically" unstable. If the half-life is several sextillion years, then we would never, never, never be able to use it to date anything."

      Neither did I ever say that?

      Philanthropy2012:

      And yes as Steve is hinting at, all atoms seem to have a radioactive lifetime (we date things using half-lives) so eventually all atoms break down into their sub particles and re-form into new atoms, usually starting from hydrogen (alpha particles).

      Lone77Star:

      "you'll see that this suggests that fission breaks down into sub-atomic particles and reforms into other elements." Yes, atoms break down and the sub particles re form to form usually Hydrogen atoms, although sometimes Helium and lithium instantly which then go on to make other atoms... What is your problem with this concept?

      (http://en.wikipedia.org/wiki/Big_Bang)

      "Heavier elements like helium and the "metals" that are heavier all form from nuclear fusion within a star, not from fission as you suggest." When did I ever suggest such a thing?

      I said that atoms undergo nuclear fission. Then the components of those atoms are left. These components will eventually reform into new atoms. I never said nuclear fusion, the breaking down of an atom, causes new atoms to be formed, as you accuse me of doing.

      My point was that all atoms eventually (as far as science can guess) break down, so no atoms are eternal. Which was in reply to LewsEthics' question about eternal matter and dating it.

      I do not appreciate your using strawman fallacy in such a blatant way.

      ("And now you're adding to the error by suggesting that all elements have a half-life. No! Some are "theoretically" unstable, but this hasn't been proven. Plus, there are some that are not even "theoretically" unstable.")

      Don't be so sure of yourself. Don't believe him Ropy!

      No, all atoms may be capable of decay in theory. We have just created gradients of when to say "we know these are unstable" when to say "we know these are theoretically unstable" and "these are probably stable, though only in the sense that it would take such a long time for them to decay that it serves no purpose calling them stable"

      Check this link out for more information, taking note of the exceptions and their implications :)

      http://www.reddit.com/r/askscience/comments/m604a/...

    • lone77star profile image

      Rod Martin Jr 5 years ago from Cebu, Philippines

      @Philanthropy2012, it's been fun and challenging. Thanks!

      And yes, I create new definitions or even new words when the old doesn't work. That's called progress. Science does it all the time. Our culture does it, too. The language evolves. Some people resist this, because they want to hold onto the old ways. And that's okay, but then they have a hard time understanding new things.

    • lone77star profile image

      Rod Martin Jr 5 years ago from Cebu, Philippines

      @Philanthropy2012, infrared spectroscopy is not the same thing as "red shift" and cosmic expansion.

      Infrared spectroscopy is used in the study of absorption and emission spectra. "Red shift" is a distortion of all wavelengths of a stellar or galactic source because of cosmic expansion. Two completely different ducks.

      Red shift doesn't become significant until you're long past our galaxy and the most distant planets subject to infrared spectroscopy are within our tiny neighborhood of the Milky Way galaxy.

      You're misinterpreting the scientific data.

      And on isotopes, you're wrong, again. Here's a quote:

      "Only 90 nuclides from the first 40 elements are energetically stable to any kind of decay.... An additional 165 are theoretically unstable to known types of decay, but no evidence of decay has ever been observed."

      http://en.wikipedia.org/wiki/Stable_isotope

      So, 165 of the 255 stable nuclides are "theoretically" unstable. If the half-life is several sextillion years, then we would never, never, never be able to use it to date anything.

      And if you re-read what you originally wrote, ("...all atoms break down into their sub particles and re-form into new atoms,..."), you'll see that this suggests that fission breaks down into sub-atomic particles and reforms into other elements. Everything I've read on the subject in the last 50+ years disagrees with this assessment.

      Yes, new matter (hydrogen only) can be formed from sub-atomic particles, but not new isotopes from fission as you described. Like I said, nature doesn't field strip a decaying atom into its component parts and then re-assemble them into the two smaller isotopes.

      Heavier elements like helium and the "metals" that are heavier all form from nuclear fusion within a star, not from fission as you suggest.

      @Ropy, are you really reading what I wrote, or simply skimming? Carbon-14 was merely an example.

      I hope you understand the correction, now.

      You blew it on saying that cosmic "red shift" studies applied to planets. I've studied this stuff for half a century and you got it wrong. Okay?

      Perhaps I'll write an article on this for my astronomy website.

      And you got it wrong again with the nature of nuclear decay. It don't happen that way. And now you're adding to the error by suggesting that all elements have a half-life. No! Some are "theoretically" unstable, but this hasn't been proven. Plus, there are some that are not even "theoretically" unstable. Got it?

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      Hey AntonOfTheNorth, thanks for stopping by, Steve has dropped this subject and hasn't replied so I can only imagine he's given up due to a lack of interest.

      It was very clear what we were arguing about:

      Steve"I contend that there are 0 scientific theories of the creation of the universe. I've asked for one and have yet to be given one"

      Then I posted that Cosmology is the science of the origins of the universe and said that a science is a science because it uses scientific evidence and scientific theories.

      "Cosmology is

      1. The science of the origin and development of the universe. Modern astronomy is dominated by the Big Bang theory, which brings together observational astronomy and particle physics."

      and then he didn't reply :(

      He also said that the big bang theory wasn't a theory for the creation of the universe several times. I guess that definition was check-mate for him.

      Nevermind! I found Lone77Star to debate with :D

    • profile image

      AntonOfTheNorth 5 years ago

      Hi philanthropy and Steve Orion

      Sorry not to respond to the requests to mediate. I've been away.

      You are both much better versed in the science than I, so I'm not in a position to mediate that aspect of the debate. My only suggestion is to discover what it is that you disagree on. I think it has become a debate of accuracy of terms rather than of the actual concept. I would try to discover what it is that you actually disagree on. Clearly you don't agree on the terms that each of you is using, but what does it mean to the central argument? What points are you trying to make OTHER than the accuracy of the terms you are using?

      I realize that this might be too late to be of any help, or no help in any case, but that is the question I am asking when I read the comments. What is the focus of dispute other than use of terms?

      for what its worth

      cheers

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      (""if you assume that mass needs to be created. You must also assume that a creator needs to be created." "Must?" Why? Because you say?")

      No, because it is a logical conclusion. If you like, here are the steps:

      If you take:

      something that is not nothing needs to be created as true.

      Then if mass is something and not nothing it therefore needs to be created. Is true

      Also, God if God is something and not nothing it needs to be created.

      Now that's logic. It's not semantics. It's simply logic.

      ("if you want to win points in semantics, well you may be well on your way to an award. Bravo! But if you want to understand the way things are and to arrive at a solution, you need to see beyond the literal. You need to let go of the "security blanket" of physical reality.")

      The"security blanket" of physical reality? Is that your expression to attack rationality and logic? I have no doubt that you function rationally and logically in all other aspects of your life (otherwise you are typing from a mental institute because not thinking rationally is a very dangerous disorder), so why do you cease at this point and simply say "forget logic, let's try magic"

      "By your logic, we must assume that, because a human can paint a painting a rock can, too." and how is that? No, by my logic:

      A rock is something and not nothing therefore it must be created

      A human is something and not nothing therefore it must be created

      Where did I say anything about matter having consciousness or the ability to paint?

      "Understandably, you have a hard time considering the "paramita" -- the Zen "one-sided" coin of things. This exists outside of space-time-energy-matter. In this realm, the laws you cling to do not exist."

      Understandably, I will not cease to believe in rationality and using information I have to make conclusions instead of making stuff up on no basis? Yes. Very understandably indeed.

      It's all very well and good saying "yeaah man, just forget logic and rational thinking, take a leap of faith and believe in things that don't make sense, it'll be much clearer then.." but why would anyone do that?

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      "But, of course, you have the ability to create definitions that block out all hope of understanding or of solution"

      Not once have I made up definitions for words. I have used dictionary definitions. You on the other hand have made up definitions for words with which you try and make a "solution". When a word doesn't fit the description of what you want, you use a different one (for example, instead of 'omniscient' use all 'knowledgeable' or 'partially knowing')It is not accepted to change the definition of people's words so that your argument makes sense.

      ("Set a rock in front of a canvas and see how well it paints the landscape before it. A rock cannot "think" to deduce "I am."

      If you want to equate solid "matter" to "God," go right ahead. But rocks can neither create universes nor paint paintings.")

      Yep but that's because rocks exist and we know what they do.

      In your analogy, you are simply stating that God exists. By your logic, I can say that the rock does have the ability to paint and think "I am". In fact, by your logic, I can tell you that the rock created the universe. I have no basis for such a claim, just like you have no basis for telling me that God exists.

      "I've been outside of my physical body and seen with clarity equivalent to that experienced by my Homo sapiens eyeballs. Breathtaking experience. This proved to my own satisfaction that I am a spiritual (non-physical) being." That's called a hallucination Mr LoneStar :S

      People get inebriated or high on drugs, and see and experience all sorts of "miracles". It is part of the human condition to hallucinate, rather than believing in the irrational, why not try and analyse what you saw and your mental state at the time.

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      Lone77Star,

      Here is a link of an abstract referring to infrared spectroscopy of both planets and suns: http://www.opticsinfobase.org/abstract.cfm?URI=ao-

      ("And on the subject 11 days ago about half-lives, that's not exactly how it happens. "All atoms" don't break down into their sub particles. Only certain isotopes experience fission that yield the half-life you discussed. A great many isotopes are stable. And nature doesn't field-strip an atom and then reassemble two atoms as you seem to suggest ("...all atoms break down into their sub particles and re-form into new atoms,...").")

      As far as I am aware, the general consensus in the scientific community is that the term "stable" isotope is given to an isotopes who's half life is very long. Not eternal, but almost so. Therefore all atoms do have a half life.

      http://www.cs.nmsu.edu/gk-12/?page_id=290

      "stable isotopes exist asthey are for very long periods of time (essentially forever)"

      And the sub particles do indeed form new atoms? Usually starting from Hydrogen Ions (protons) into hydrogen atoms (adding available neutrons and electrons), then into helium etc.

      And then radiometric dating does not rely on solely on carbon-14 etc. Yes we need to know the atmospheric ratio for living organisms. We only need to know the isotope ratio's of non organic matter today and the half lives of the radioactive ones to find out how long it took for the ratio to change that much, finding it's age?

      We use uranium-238, uranium-235 and potassium-40 for older items where possible. What was the correction you were trying to make?

    • lone77star profile image

      Rod Martin Jr 5 years ago from Cebu, Philippines

      @philanthropy2012, you said, "if you assume that mass needs to be created. You must also assume that a creator needs to be created."

      "Must?" Why? Because you say?

      If you want to win points in semantics, well you may be well on your way to an award. Bravo! But if you want to understand the way things are and to arrive at a solution, you need to see beyond the literal. You need to let go of the "security blanket" of physical reality.

      Again, a rock cannot paint a painting, but a thinking human can. Granted, both are made of physical matter, but the human possesses awareness and some semblance of control.

      By your logic, we must assume that, because a human can paint a painting a rock can, too. In the illogicalness of this viewpoint is the essence of the point I'm trying to make. If you can understand that, you will see where I'm coming from. I've built the bridge as far as I can. You have to take a leap to meet that bridge of understanding. And you may have to look at the impediments you're putting in your own way.

      Understandably, you have a hard time considering the "paramita" -- the Zen "one-sided" coin of things. This exists outside of space-time-energy-matter. In this realm, the laws you cling to do not exist.

    • lone77star profile image

      Rod Martin Jr 5 years ago from Cebu, Philippines

      @Philanthropy2012, you make an interesting point when you say, "Saying things like 'He is the source of all meaning and substance' is as strong an argument as my saying 'matter is the source of all meaning and substance'." ;)

      Try this:

      Set a rock in front of a canvas and see how well it paints the landscape before it. A rock cannot "think" to deduce "I am."

      This is a rough analogy, granted. But, of course, you have the ability to create definitions that block out all hope of understanding or of solution. If you want to equate solid "matter" to "God," go right ahead. But rocks can neither create universes nor paint paintings.

      -------------------

      Examples:

      From my own personal experience (empirical evidence, at least for me).

      I've been outside of my physical body and seen with clarity equivalent to that experienced by my Homo sapiens eyeballs. Breathtaking experience. This proved to my own satisfaction that I am a spiritual (non-physical) being.

      I have experienced many miracles including one very interesting one in traffic on a major boulevard in Los Angeles (mentioned in my "Anatomy of a Miracle" hub). This proves to me our individual abilities to circumvent the laws of physical reality and that we are baby gods created in God's image.

      I'm not talking about the Homo sapiens body, here. Or even the ego.

      I don't yet "know" God, but logically I can understand His existence from my own empirical experiences. And I think that's what all religions have as their purpose -- to awaken spiritually to a state of enlightenment (ability to see without physical instrumentality, including the biological ones), where they can see the source of all things.

      I've only taken baby steps in that direction.

    • lone77star profile image

      Rod Martin Jr 5 years ago from Cebu, Philippines

      @Philanthropy2012, in your discussion with @LewSethics 10 days ago, you spoke of red shift and planets. Please note that planets are not subject to such red shift. No planets at the far "side" of the universe are detectable -- only quasars and galaxies. Even individual stars are too dim at most red-shift distances.

      Planets only reflect light and pitifully little of it compared to the brightness of stars and galaxies.

      And on the subject 11 days ago about half-lives, that's not exactly how it happens. "All atoms" don't break down into their sub particles. Only certain isotopes experience fission that yield the half-life you discussed. A great many isotopes are stable. And nature doesn't field-strip an atom and then reassemble two atoms as you seem to suggest ("...all atoms break down into their sub particles and re-form into new atoms,...").

      And such radioactive decay is good for determining ages only if we know the concentration at formation. For carbon-14 dating of living material, we know the proportions of carbon-14 to carbon-12 in the atmosphere. When the organism dies, respiration stops; this is when the clock starts.

      Hope this helps.

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      "You assume that a creator needs to be created"

      Lone77Star, if you assume that mass needs to be created. You must also assume that a creator needs to be created.

      If you say "nah a creator doesn't need to be created" then I can say "nah mass doesn't need to be created" which renders a creator obsolete once again.

      Saying things like " He is the source of all meaning and substance" is as strong an argument as my saying "matter is the source of all meaning and substance"

    • lone77star profile image

      Rod Martin Jr 5 years ago from Cebu, Philippines

      @Philanthropy2012, you bring up an exciting topic. I happen to agree that both of the methods you propose are not strong ones for the creation or formation of the universe.

      But your "Creator" argument has one major flaw.

      You assume that a creator needs to be created. That's not the case. While everything in the physical universe can be both cause and effect, God is (to use a Buddhist term) "paramita" cause. The perfection of cause. He is the source of all meaning and substance. All reason and logic are built on the foundation He created.

      Imagine a nothingness where matter, energy, space and time do not exist. The continuity of physical reality, as we know it, does not exist. There is only source of creation.

      In the realm of God, creation and spirit, such things as evil, stupidity, indifference, victim, doubt, effect, selfishness and other negative halves of mortal dichotomies cannot exist. Only goodness, wisdom, compassion, confidence, cause, and generosity can exist there. But these do not look like their physical universe counterparts, each of which is bound to its opposite. In Buddhism, for instance, "paramita generosity" does not look like mortal generosity. Every act of mortal generosity is tainted with its opposite, selfishness. This is a tough idea to grok (understand in its entirety), but it is a prerequisite to talking about God and creation with any depth of understanding.

      It's not easy to imagine these things. Talking about subjects that are outside the realm of physical reality, but superior to it, is not easy.

      Why is God interested in this tiny little planet? He's not. In fact, He's not interested in these Homo sapiens bodies, except as a tool to help rescue his children -- the immortal spirit within. That's the real, immortal you behind those beautiful Homo sapiens eyes.

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      Also here is a lot of scientific proof and the scientific theory for the FSM:

      http://www.venganza.org/about/open-letter/

      Philanthropy,

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      Cosmology is

      1. The science of the origin and development of the universe. Modern astronomy is dominated by the Big Bang theory, which brings together observational astronomy and particle physics.

      2. An account or theory of the origin of the universe.

      (http://www.google.co.uk/#hl=en&q=cosmology&...

      The definition includes both that it is a scientific study, which naturally includes scientific theories. (Which you argued against)

      And also that cosmology itself can be a theory.

      And also that The Big Bang theory is cosmology, and is an attempt at explaining the origins of the universe. It specifically states that The Big Bang theory is a scientific theory of the creation of the Universe. That's the dictionary speaking, not me.

      You can disprove the FSM, you can find the true creation of our Universe.

      Ergo, it is falsifiable.

      Also, since you refer to that website by Don Lindsay, I must tell you that I throw huge question as his credibility as a scientist. He seems to be qualified in computers. He also seems to falsely criticise real scientists "http://www.trueorigin.org/ca_it_01.asp" . Therefore I find your reference to his work moot and unreliable. With no signs of a degree or any authority in science, referring to him is much like me referring to a hubpage for scientific definitions.

      What appears to be the case Steve is that we are at a loss when it comes to communicating, so I suggest that we wait for a third party such as Anton to give an unbiased opinions as to what is happening.

      Philanthropy,

    • Steve Orion profile image

      Steve Orion 5 years ago from Tampa, Florida

      Philanthropy, tell me how cosmology, which is the STUDY of the universe, is a theory of the creation of the universe. Tell me how I made that up that cosmology has put forth no theory on the creation of the universe. What theory exists on that? (I've addressed how the Big Bang theory does not explain the creation of the universe, the notion that you would say we have a scientific theory on the matter clearly illustrates who's making things up.)

      While I wasn't surprised that you skipped over the first definition of the link (it didn't fit your argument, after all) the second definition still defeats the concept of the FSM being a scientific theory. The fact I have to tell you this this late into the discussion (that Creationism is not a scientific theory, and that scientific theory is the only definition of theory that matters.)

      AKA you can not DISPROVE the FSM, nor the Tooth Fairy. How mythical beings are "subject to experimentation" is beyond me, care to share some more enlightenment with all us scientifically-challenged ignorance-spreaders?

    • profile image

      jenubouka 5 years ago

      Yes, as with all ailments of the unknown, if I can't touch it, see it, taste it, or hear it does it mean it does not exist? Am I willing to live with such constrictions? No. This great wide universe is beyond any one "free will" You want something you got to go out and grab it whether it means it is wrong or right in one's eye. Is there risk of persecution? Yes, whether you believe in the judiciary system or the damnation of a higher power maybe like Karma it all will boil down to how you want to live your life. In the sense of what ails you to better your self, defying an existence that has not shown their face yet the followers beckon its there or to those who choose to kick and scream at the thought of an almighty having all the power.

      Isn't that what it comes down too? The weak and the strong, to admit question and doubt are we admitting our weaknesses or strengths?

      All I know, and excuse the language but it is just how I am, but, I have really I mean really done some fuct things in my life, put my life in dangers way, never really thought of consequences that may arise in my destruction, just lived and said to hell with all of you anyway, yet here I am, safe and sound. Freedom of choice, defying any and all who challenge me, and when I brave the realities of the unknown, when I open my mind to the unseen well that's when things just get started. If one opens the door to supernatural existence they must be prepared for allowing everything in. See, I didn't know I had opened that door, and to this day I am haunted with the realities of never closing the door.

      Maybe I am a bit mad, in the sense of "off my rocker" yet I am sure enjoying the ride of finding it all out someday. If God wants to "knock" on my door from time to time and throw me a curve ball well, that too is all the more welcome, I would never turn away the opportunity, would you?

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      Ahh, thank you Jenubouka, that is very interesting, but it sounds like you are more of an agnostic than a theist/deist?

    • profile image

      jenubouka 5 years ago

      What I believe? Oh you mean if I believe in God, note I did not use a or plural. There is your answer, yes I do. Yet not in the sense I dismiss all other explanations on how we walk in life, that would be ignorant and useless. I as well as everyone else, was given free will, and with my free will I choose to enlighten my mind, my world with different outlooks of "why is this this"

      When I find my voice to tell my story perhaps the ones who dis enable the God theory will respect why I cannot. Circumstances are too great, survival of my path in life just tend to lead me to believe. My Aunt raised me for a stint and she was a strong I mean strong believer, yet she always embraced my staved walk and infinite questions about the unknown. If a believer in God is someone who wants to learn all walks in life and allows room for questions that to me is a good thing. For those who claim to only see God's path in life and no other, well then they must need to locate the map once again.

      Is he fair? Is he just? Is he always right? I only can answer for myself and choose not to burden others with why. Can we be just in finding anger for his wrath? Of course.

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @Planks

      I would have to strongly disagree!

      DNA replication is not necessary for life, only for the continuation of life I.E. a cell will survive without replicating its DNA, but since it won't reproduce, the colony won't survive.

      And all that is necessary for transcription and translation are the organelles (not even them in simpler prokaryotes). And by organelles all I mean is ribosomes. Rough endoplasmic reticulum and the ER, not even a golgi apparatus for the simple cells are needed as far as I'm aware in the simpler bacteria and no membrane bound organelles are present in prokaryotes anyway!.

      The reason that they didn't make the organelles themselves is because there is simply no point in doing so. What benefit would they have had from doing so? It would just achieve the same thing. But knowing that you can synthesize a genome into the real world was necessary because you could then change the genome and make new life. It was unprecedented.

      Scientists have already made artificial ribosomes!

      http://www.thecrimson.com/article/2009/3/10/scient...

      So what point would there have been in spending valuable time on making their own ones?

      ----------

      What is wrong with your analogy is that first of all, we knew what the genome was, what roughly each section did of the genome and which genes they coded for. That's evident in the fact that they spent months looking over the genome to find a mistake in a vital process of cell development and fixed it.

      Another thing wrong is that the language that was "copied" was not word for word. As the article says, it's the first bacteria to have a web site in it's genes "It's also the first species to have a Web site in its genetic code".

      So in your analogy, what would be more true to say is "a person can copy and alter a sophisticated language and maintain it's functionality and then claim it made a new language"

      Because after all, not only did they make the type of bacteria, they in fact altered it, they made a new type of life, not just life.

      ----------------

      "The result is that there is still too little understanding of the extremely complex language, code, and nano-machines that are *essential* for a self-producing living organism."

      That's not a true statement at all! It's true only perhaps for the most complex eukaryotes. But for simple prokaryotes and bacteria's (this one was one of the simplest bacteria), we know exactly what organelles are responsible for what processes.

      Ribosomes are responsible for translation, and we know how to make them (we're in the process of altering them to make never before seen proteins!)

      I don't know what other "nano machines" you are referring to. The first cells were very simple in structure and we have been able to work out the fundamental machinery that is used.

      All that is needed to translate is ribosomes after all. RER (rough endoplasmic reticulum) and the ER (endoplasmic reticulum) speed along the process and allows synthesis of lipids, but they aren't necessary. Certainly not in simple bacteria like the

      Mycoplasma mycoides bacteria.

      Transcription is very well understood to, requiring DNA polymerase and all of the other named enzymes that we can synthesize.

      -------------

      Even within the very article it states " Venter and his colleagues used a synthetic genome—the genetic instruction set for life—to build and operate a new, synthetic strain of Mycoplasma mycoides bacteria". New synthetic strain of mycoplasma being key to the statement "new artifical life".

      It boils down to this question: before this experiment, did this strain of bacteria exist?

      No being the answer.

      ----------

      I'm not sure how learned you are in cell biology, but it's worth mentioning:

      I take your point then that the ribosomes in this case were not created via man made components and they simply used a ghost cell's.

      However, since that cell replicated, and since ribosomes are produced from the (synthesised, man made) nuclear genome (http://www.newton.dep.anl.gov/askasci/mole00/mole0... then it is apparent that in all of the new cells, ribosomes were created by the man made genome, and ergo, created by man.

      So even if you argue that the first cell was not completely man made, you would find difficulty arguing that all of the cells after were not, since the non-man-made ribosomes were only used in the first cell.

      So I would say, considering the fact that a new unprecedented living organism was created, and the fact that the second generation of cells were all derived from man made components, the title "artificial life was created" holds true.

    • PlanksandNails profile image

      PlanksandNails 5 years ago from among the called out ones of the ekklesia of Christ

      Philanthropy,

      ("Then put it into a ghost cell and voila, life!")

      Taking a closer look would reveal a remarkable achievement by Craig Vetnor; however, it may sober up the euphoric glossy information in this dialogue.

      Three essential systems are *required* to be in place simultaneously in order for the process of life to function.

      1. The duplication of DNA (Vetnor and hist team accomplished the first generation).

      2. DNA code is transcribed into mRNA (the recipient cell had all the machinery required; Vetnor and his team did not attempt to synthesize this step).

      3. The translation of RNA code into the synthesis of multitudes of protein nano-machines that are required for DNA replication, RNA transcription, protein synthesis, energy conversion systems, etc...

      In essence, all the systems were provided by the recipient cell.

      There is extensive knowledge about DNA coding for protein, but the other levels still far exceed our understanding.

      The fact is that no life was created. In simple layman's terms, the DNA of existing life was copied and manipulated. For example, a person can copy a sophisticated language word for word that is unknown to the individual, and then claim that he had written a book in that unknown language, and publish it. This is essentially sophisticated plagiarism. You copy what is already there.

      What Vetnor demonstrated is that you cannot trust the headlines which read, "Researcher Craig Vetnor has created artificial life - WE ARE GOD."

      Vetnor's accomplishment and findings are still an achievement, but it would be arrogant to claim something that far exceeds what actually happened.

      The result is that there is still too little understanding of the extremely complex language, code, and nano-machines that are *essential* for a self-producing living organism.

      We can assert that physical-chemical processes do indeed require an extreme amount of intelligent information.

      The headline said that artificial life was created. Artificial life is an oxymoron.

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @Borsia,

      I agree with everything you say and it's exactly the argument I'm putting forward to Steve.

      Although on a side note I would like to point out that what the scientists did in the experiment was not modify DNA to create something new.

      In this one what they did was decode the genome of one of the most simple bacteria (they started with the simplest but it was slow reproducing). The genome of course being the base sequence for the entire organism. Like we are trying to achieve of the human and many other organisms.

      Once they had that on a computer. They were able to work backwards. Using the genome as the instructions for the sequence of bases necessary to create the bacteria's DNA. That DNA was then inserted into a ghost cell and then proteins were made to differentiate the cell into the original bacteria which was able to replicate!.

      As a result, this was the first (known) successful usage of a genome and base input computer to create life out of inorganic molecules!

      All they did, was take an organism, take it's DNA, and then use the molecules necessary to remake that DNA with a computer to make the DNA. Then put it into a ghost cell and voila, life!

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @Steve

      "was there no genome already present in any cells used?" No. Nowhere in the article does it state that. It specifically says that the genome was synthesised from the 4 bases of DNA

      "in other words, a chemical synthesizer stitched together various short iterations of man-made adenine, cytosine, guanine and thymine that were then assembled into a working genome that can successfully produce the proteins that enable life."

      This sentence in layman's means "we used man made components of DNA (Adenine, cytosine, guanine and thymine) and ordered them using the blue prints of an existing bacteria (a genome, the correct sequence of bases that make up the organism) that is able to reproduce.

      At no point does it say anything about using non man made substances to create the organism. The genome is the data, the instructions, all it is the thing that says "you need to put ATGCATGCGCGCGCGCGCGATGCATGCCGTAATCG etc... to get this organism". The genome is data on a computer file. It is instructions.

      Anton, please mediate and give your opinion, to me it seems like no confusion could be made here.

      ---------

      The spaghetti monster:

      a coherent group of tested general propositions - these tested general propositions is that we exist. The test is that of our existence, is using sensory organs to acknowledge our existence.

      commonly regarded as correct - Even des cartes himself and 'cogito ergo sum' regards our existence to be true.

      that can be used as principles of explanation and prediction for a class of phenomena- the phenomena is how we came to be, and the explanation: the spaghetti monster.

      Even without that desperate attempt, and once again Anton, I would like you to witness this, Steve is taking only 1 usage of the word theory. On the exact same link that he refers to, under the number "2." is this definition:

      "a proposed explanation whose status is still conjectural and subject to experimentation, in contrast to well-established propositions that are regarded as reporting matters of actual fact."

      A proposed explanation whose status is still conjectural and subject to experimentation.

      The proposed explanation is that the spaghetti monster created us. It is conjectural perhaps, and is subject to experimentation maybe, but it fits the description does it not?

      Your opinion Anton?

      ======================

      As I have previously explained, by essentially, I mean in essence there are two theories, these theories are broken down into sub-theories, which are still called theories, so I do not appreciate this "being essentially two theories and they are both terrible ANd there is a huge amount of theories as well" because the word 'essentially' differentiates "There is" into "At a basic level, there is". A synonym of essentially of course, being basically.

      ===================

      Anton, it is getting increasingly frustrating because of the reason that Steve just states incorrect things over and over again. Clearly he has not looked into any of the things he says otherwise things like the following would not happen:

      cos·mol·o·gy/käz?mäl?j?/

      noun?/käz?mäl?j?/?

      cosmologies, plural

      The science of the origin and development of the universe. Modern astronomy is dominated by the Big Bang theory, which brings together observational astronomy and particle physics

      An account or theory of the origin of the universe

      (http://www.google.co.uk/#hl=en&q=cosmology&...

      And then the statement of his that "cosmology is not a theory of the creation of the universe, believe it or not."

      How can you argue with a person who is bent on believing things that he has made up?

    • Borsia profile image

      Borsia 5 years ago from Currently, Philippines

      0 theories?

      There are countless theories about how life came to be, some more scientific than others but a theory is nothing more than a speculation of how things happen, it doesn’t require any proof that it did.

      Many believe that if you can create the substance of the primordial soup in never ending variations and strike it with lightning enough times that you will spark the beginnings of life. This is probably the most accepted theory and there have been many attempts to replicate this but no success. Nature worked on it for over a billion years

      Again Darwin never attempted to say where that first spark of life came from. In his time they didn’t have any knowledge of the most ancient life forms. He speculated that at some point all life may have had a common origin. But Darwin, who was a theist, didn’t see the possibility of animal and plant life having a common beginning. It is modern science that has traced things back to what is the beginning. But, while there are many theories, they have been unable to ascertain how life came to be.

      I think you are mistaking how man synthesized bacteria and viruses.

      They take existing bacteria and manipulate the genome into something that doesn’t occur in nature. They aren’t starting from scratch they are modifying the instructions IE DNA.

      The same thing goes for the virus. They didn’t put a bunch of stuff in a test tube and shake it up they manipulated an existing virus into another form.

      Synthesize = combine into a coherent whole; In other words, to take existing things and recombine or alter to your desired end.

      The Flying Spaghetti Monster as a scientific theory?

      No it’s not, and we know it is not because we know who came up with it and when.

      Some college students were involved in the philosophy of religions and one of them saw something in a painting that looked like a flying bowl of spaghetti. They then joined to make their own spoof religion. The joke caught on and spread from there.

      OP is correct I left out a word when I described the timeline of life I should have said “animal life”.

      The theory of creation can only work if the god in question sent the first spark of life and then became distracted and forgot about the whole thing. As for the biblical storyline there are so many holes, but perhaps the most glaring is that we are the 20th incarnation of the human form, 19 pre-humans plus Neanderthal.

      Neanderthal not only lived at the same time as modern man they interbred, unless you are of pure African decent 4% of your DNA originated from Neanderthal.

    • Steve Orion profile image

      Steve Orion 5 years ago from Tampa, Florida

      Oops I posted without linking the site: http://www.don-lindsay-archive.org/creation/falsif...

      Anyway@ AntonOfTheNorth

      I contend that there are 0 scientific theories of the creation of the universe. I've asked for one and have yet to be given one. I won't state what he contends as no matter what I say I'd be accused of misquotation. Read his comments about there being essentially two theories and they are both terrible ANd there is a huge amount of theories as well (can both be true? Don't ask me how.)

      "His idea is that in all of cosmology, there is no science being used at all."

      Refer to my previous comment of even previous paragraph to see, Anton, what I ACTUALLY said. =) Cosmology is not a theory of the creation of the universe, believe it or not.

      You're absolutely right Anton about discussions of these sorts of things! My apologies to all if I seem aggressive or anything of the sort.

      Now, the Big Bang and the theory of evolution do not, as I've said time and time again, serve as theories to cration of human beings. Big Bang = Universe. Evolution = advancement of organisms through natural selection.

    • profile image

      AntonOfTheNorth 5 years ago

      Just a thought. Is it breaking down on the word 'creation'?

      Is it Steve Orion's position that the theories deal with what happens after creation, but are silent on how the actual act of creation is possible or took place?

      If so, doesn't philanthropy and anton both agree with that? That we don't know how or if the moment of 'creation' occurred?

      I think the dispute centres on 'what do we mean by creation' Are we saying something came from nothing, or as I had pointed out to me in another hub, are we talking about an 'assembly' out of an existing 'eternal' matter?

      I think that's where the issue is. Just a guess.

      cheers

    • Steve Orion profile image

      Steve Orion 5 years ago from Tampa, Florida

      You are right on the virus article, I was not reading carefully in the preliminary introduction to the article so I missed that, my mistake. No matter, as if you search "Are viruses living?" on any search engine you can get millions of pages debating and speculating. Also the argument is brought up in any of your intro to Bio classes when learning of what constitutes a living organism.

      Concerning the bacteria, was there no genome already present in any cells used? "in other words, a chemical synthesizer stitched together various short iterations of man-made adenine, cytosine, guanine and thymine that were then assembled into a working genome that can successfully produce the proteins that enable life." The article goes on to say, I'm sure you know, that the FINAL PRODUCT was a synthesized genome. Ask yourself this quesion: were no living materials used in this experiment? A quote from a biological engineer confirms, it's not genesis. In short, HUMANS HAVE NEVER MADE LIFE FROM NON-LIFE! I'd think there would be a bit more commotion if we did.

      "The Flying Spaghetti Monster is also a scientific theory, prove to me that it isn't."

      Source: http://dictionary.reference.com/browse/theory

      a coherent group of tested general propositions, commonly regarded as correct, that can be used as principles of explanation and prediction for a class of phenomena: Einstein's theory of relativity.

      They also must be falsifiable, according to other online dictionaries. It is a joke that the Flying Spaghetti Monster is a scientific theory. This is where the clearest fallacy is, I'm pointing right at it. Ask any scientist if The FSM or the concept of Creationism are scientific theories and you'd get your answer. Here is another site that you might get some use out of (but probably not).

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      As I see it this is what happened: perhaps both you and Steve can review and tell me if something is wrong:

      This was the OP:

      "Scientifically speaking, we have 0 theories on out "creation" other than speculation on when and how our tree of life began."

      I then go on to talk about evolution and the big bang theory to which he replies "that has nothing to do with "creation" changing his argument away from the creation of humans to the creation of the universe despite saying "out creation" and "tree of life" in his OP. I then tackle that response and we got lost arguing about the definition of genome, theory and scientific theory. Sad :( Help us Mr North, mediate the ordeal!

    • profile image

      AntonOfTheNorth 5 years ago

      At the risk of sounding glib...patiently.

      In emotionally charged debates (politics, religion, sociological norms) and even with you and I, it took some effort and patience on both sides to thread through how the argument was being made in order to arrive at the argument itself.

      We're going to make blinding errors when our only communication is words on a screen, particularly if we have different nuances to the definitions of the words we are using. Offense, real or imagined is really inevitable.

      I try to start from the theatre notion that 'the audience is always right' If you think I've said something when I meant another, I try to restate it, rather than tell you why I think you misunderstood.

      It makes me a little verbose, I confess, but I gain more out of the discussion than if I assume my 'audience' is doing something wrong. I assume instead that I need to say it differently.

      not always successful, but that's the premise I go in with.

      for what its worth.

      cheers

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      Anton, Steve contends that the issue is that there are 0 scientific choices whatsoever.

      His idea is that in all of cosmology, there is no science being used at all.

      He is also confused of the definition of the word "genome"

      Tell me Anton, how do you deal with an opponent who uses words he doesn't understand?

    • profile image

      AntonOfTheNorth 5 years ago

      uh oh. The Flying Spaghetti Monster is out again.

      This critter usually arises in the god/no god debate when emotions are triggered.

      Written media in an emotional debate is not our best medium.

      You are both intelligent and educated. You have a difference of opinion and some communication attempts have failed, that's all.

      I'm finding the argument interesting, but I'm losing what the debate has become about. Any chance we could step back a touch and see what we're arguing about again, in the context of the hub?

      The question is 'Why then, would anyone choose the latter (an entity caused matter) over the former (don't know what caused matter)?'

      Steve Orion contends that the issue is that the two choices are not scientific and that there are more than two?

      philanthropy contends that the creation theories boil down to those two and that they are scientific?

      Ironically, I might be oversimplifying and missing something important.

      Oh golly! That's sort of my point isn't it? ;)

      cheers

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @Steve, you are right It's in the title:"Man-Made Genetic Instructions Yield Living Cells for the First Time" The "genetic instructions" ARE the genome. The genome WAS synthesised. The genome WAS synthetic. How could you possibly argue that the genome, the genetic instructions, (the DNA), was not synthetic when you yourself said "The DNA was synthesized"

      I think you still haven't realised what a genome is.

      Please clarify why the cell was not made from scratch because the genome is the genetic data which is not under dispute of being synthesised or not.

      "Also, are you saying that I learned that there was a debate about whether or not viruses are living from your second link? Give me any quote from it that mentions anything about that."

      Third sentence of the article "Scientists are divided about whether a virus is alive."

      This is great proof that you have an inability to understand or fully read what an article says.

      " Now who's the one every scientist in the world would disagree with? Both sides of an argument you presented in your Hub fail to qualify as a scientific theory. Practice what you preach and use Google."

      What you have done there is stated something. You have provided neither an explanation for how they are not scientific explanations nor any outside proof.

      The Flying Spaghetti Monster is also a scientific theory, prove to me that it isn't.

      You have just been stating things without any knowledge of science or debate, that much is clear from your fallacies. Please, if you wish to denounce me as the same thing, point to where I have made fallacies.

      Philanthropy.

    • Steve Orion profile image

      Steve Orion 5 years ago from Tampa, Florida

      Read your own source. The genome was NOT SYNTHETIC, everything that was used was not man-made. Why can you not see that the article does not support your claim that man mas made life from non-life, in a lab? Did you read as far as the title and header? I'll give them you you. "Man-Made Genetic Instructions Yield Living Cells for the First Time"

      "Scientists create the first microbe to live under the instruction of DNA synthesized in the lab" As the the DNA was synthesized, the cell was living under the "instructions" that were man-made. Not to embarrass you.

      Also, are you saying that I learned that there was a debate about whether or not viruses are living from your second link? Give me any quote from it that mentions anything about that. Doesn't seem to hold much weight for something that is "no doubt" true. But let's see the best part of your response that was supposed to cause me embarrassment...

      "And as for "we are here because God created us" technically it is a scientific theory, as I've already stated in my hub."

      And YOU attempted to berate ME about my lack of scientific knowledge?! I was the one supposed to be embarrassed, for what? Arguing with someone who thinks that Creationism is a scientific theory, perhaps. Now who's the one every scientist in the world would disagree with? Both sides of an argument you presented in your Hub fail to qualify as a scientific theory. Practice what you preach and use Google.

      To say, we exist and the Flying Spaghetti Monster could explain our existence so He is a scientific theory. How absurd.

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      Credit where credit is due Mr.OfTheNorth!

    • profile image

      AntonOfTheNorth 5 years ago

      Very generous, philanthropy. Thanks!

      cheers

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @Jenubouka,

      Hey :) Thanks, i can't take all of the credit, this hub is actually a response I sent to AntonOfTheNorth on his loving creator hub, and people like you and the rest of the willing hub community provoke great discussion it seems!

      I think that all ideas must be considered, but some will inevitably look more promising than others and I think that those should be the ones we focus on first, since we can't look at everything all at once obviously, though an open mind is the only kind that will allow progress of course.

      Agnosticism seems to me the only viable option right now, may I ask what is it that you believe?

      Thanks for your comment as always,

      Philanthropy,

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @Steve Orion,

      Steve, unfortunately there is no way of saying this that won't embarrass you, so here goes:

      Do you know what a genome is? Allow me to clarify:

      A genome is the complete set of genes (DNA) for an organism, it is not at all living. Therefore they made life completely from non organic materials.

      It is like the blue prints, the instructions, but it's not living, and so they made life from the bottom up.

      Please clarify what you thought a genome is and how it at all affects the scientists' claim of making life.

      Pretend if you will (which the article taught you no doubt) that some scientists regard viruses as non living (although most do), I'll take the point, though the underlying point is that we know how to build life, if we can build viruses, we can build bacteria, which as link one already has shown you, we have.

      And as for "we are here because God created us" technically it is a scientific theory, as I've already stated in my hub. I've also already explained how it is. A terrible theory, but a theory nonetheless.

    • profile image

      jenubouka 5 years ago

      Hi Philanthropy,

      As always you raise the bar when it comes to discussions I know to expect nothing less from you.

      The what if's of existence or how we came to be, what makes us humans, or the galaxy, or that plant over there, or the air we breathe, if it really is air.

      See, there is so many questions that linger the dialect of existence. Religious believers will accept no "scientific" explanation, yet if they truly believe in free will then wasn't it their god(s) that gave scientists the capacity to ask such questions?

      For those who claim only scientific reasoning behind existence then they must accept all factors of the divided questions: Could there be an all mighty that mastered our creation, as science must acknowledge the area for doubt, some things are yet to be proven.

      The truth is as a human race, if that is what we really are, we need to embrace all walks of the unknown respect one another, whether we agree or not. Some loopy brained concept maybe the answer, yet as society will play on it, if they are not accredited then back to the nut house they go.

      Would we really be able to handle the truth of our existence? I am banking on no.

    • Steve Orion profile image

      Steve Orion 5 years ago from Tampa, Florida

      I stated how uninterested I was in your justifications, but no matter. A quote from your first link: "a chemical synthesizer stitched together various short iterations of man-made adenine, cytosine, guanine and thymine that were then assembled into a working genome that can successfully produce the proteins that enable life."

      In other words, not from scratch. They assembled man-made chemicals into an already working genome. They did not take solely nonliving materials and make something living from them. Try that Google search again.

      The second link: The assembly of a synthetic virus is not the creation of life. If that were not enough, there is plenty of debate as to whether or not viruses are even alive at all. So even IF scientists were to create functioning viruses out of nonliving materials (something not exactly expounded in that less-than-quality article) it still wouldn't be the creation of life. They didn't, as far as I can tell, so it doesn't matter. Maybe try another search engine?

      Scientific theories must be, as good ole' Goggle puts it, falsifiable. I think I know the answer, but would you say "We are here because God made us," is a scientific theory? I read both from your Hub and comments that this is the case, but I wouldn't want any more "misquoting" going on here.

      Regards,

      Steve Orion

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      Thank you A Thousand Words :)

      I've never learned about Taoism which is quite a shame but I can relate to the spirituality that you refer to that a lot of the asian countries share, not relying on Gods. The popularity of buddhism which has no worshipped God is a great example of how the deeper human pleasures are thought of as attainable without deities helping.

      I've been learning Japanese for several years and so I can also relate to your love of asian countries and Japan in particular. Everything is so spectacularly different and novel, concepts that have died out long ago or never existed in the west, exist snuggly in Japan today, and the balance between old and new is remarkable. Though on a side of caution, I'm sure there are deep social problems with all of these nations just like in the west, I think the grass is greener a lot of the time, and there'll be cons to the pro's just like anywhere else. My Japanese teacher taught me about the dark side of Japan before and it's hard to believe what goes on in some Eastern countries. You'd think that no morals ever existed, though this is all happening amidst honour and morality itself. Crazy!

      Thanks for sharing, enjoy the follow :)

      Philanthropy,

    • A Thousand Words profile image

      A Thousand Words 5 years ago

      What a great hub! This is exactly why I am Agnostic, or something of that nature. I do not claim to know 100% that there is or isn't a gpd. Our whole view on the nature of this individual could be completely wrong, or his/her/its entire existence is just our wonderful imaginations at work, but no one can say for sure. Being a former Christian myself, I was certainly QUITE convinced of His existence. After reality slapped around a bit, I was able to see the error, MAJOR ones that just didn't sit right with me.

      But when I observe Eastern thought, though some of it is just as illogical, I came across Taoism. Now, I will never subscribe myself to a religion again. But, I love the idea of what the Dao/Tao is and the idea of "de" and "wu wei." It's really one of the most interesting views on the transcendent that I've ever come across. (Now don't be thrown off by their ideas of immortality and their deities. They do not worship said deities, at least not the educated Taoist, but every "religious" view has it's flaw, which is why i subscribe to none).

      But I'd have to say at the very base of what Taoism is and how it views the Tao (definitely completely different from the Western view of a God), they would be the closest out of anyone. I love that with Eastern religions in general, except for Hinduism which really seems more like Western thought with an Eastern twist, one does not need to believe in a deity to appreciate some of the really profound views into humanity and the nature of this Universe.

      There are points in my life when I feel like I should've been born in an Asian country, preferably Japan. (I love almost everything about many of the different Asian cultures)

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @Steve Orion,

      I said no nasty comments, just suppositions on the insult that you directed at me. Spouting ignorant and uneducated comments is a huge insult to both myself and anyone who reads it, spreading ignorance is a terrible thing to do.

      Perhaps knowing how people will react to unthoughtful and time wasting comments will do everyone some good, so I would see it as far too necessary to comment on just how ignorant your statement was.

      Life from scratch? So you still choose not to just type that in Google:

      First self replicating bacteria:

      http://www.scientificamerican.com/article.cfm?id=s...

      First human-made virus:

      http://news.bbc.co.uk/1/hi/2122619.stm

      And perhaps it's a common mistake, I don't know, but the definition of theory is not limited to scientific evidence. If you did limit it to science, then you pretend that all other theories such as Mathematical theories, do not exist, which they do, and are not based on science but based on mathematical and logical conclusions. Theories can be equally based on logic and axioms as they are on scientific data.

      Also, a "scientific theory" is just a theory that explains scientific data. So when you make a theory that tries to explain why a table contains a set of data is the way it is, it is a scientific theory.

      So when you say a "scientific theory" of creation, you are saying that creation is scientific data.

      That's fair enough, the fact that we exist can be tabulated under "exists:yes" so any theory that explains why there is a "yes" for the box "exists" would be a "scientific theory" of creation.

      Therefore, saying "mass was formed out of nothing" would be a "scientific theory" because it explains the data collected which is "existence:yes"

      That said, anything that attempts to explain "existence:yes" is a "scientific theory"

      The point of the hub was to address the fact that all of these theories fall under two main categories, God and Godless.

      Both theories are only based on the scientific evidence of our own existence. Both have the same fundamental problem. And as such, both are terrible.

      Thank you,

      Philanthropy,

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @LewSethics, As Des Cartes would argue, we never know anything but our own existence. But for future reference, when I say "we know" it's of course, as it is for anyone else "we are fairly sure". Based on empirical and unchallenged evidence, the lifetimes of atoms are not in dispute. Especially since we've accurately dated objects which we knew the age of.

      What do you mean I made up infrared spectroscopy?! :L

      And here is a link of an abstract referring to infrared spectroscopy of both planets and suns: http://www.opticsinfobase.org/abstract.cfm?URI=ao-...

      And yes red shift is also a theory, with huge amounts of evidence behind it and little other theories to refute it. I wouldn't say that it can be explained by time lag of photons? (but I'm no expert)

      If the time lag is getting gradually greater, you can conclude it the distance is too? I expect that the scientists are checking the red shift at time intervals and then analysing the different amounts concluding in a distance change (expansion). And when comparing different planets of different distances we see different rates of change, we can conclude once again that some are changing faster than others?

      And there has to be at least one correct theory, so the fact that something is a theory has no relevance to whether it is true or not. It has to be a theory in order for it to also be true.

      We work on probabilities, and pick the best theory on the knowledge we have. So what's the problemo?

    • Steve Orion profile image

      Steve Orion 5 years ago from Tampa, Florida

      Before my response, I'd like to say, such hateful and nasty insults are far from necessary. I don't care to continue if you don't want to be civil. I also don't care to hear your inevitably drawn-out explanations of why all that was justified.

      I never revised my points, I reiterated in a simpler way so you could understand. Also, please give me a link or a study or anything in which it is show that we have created life from scratch. I'd like that very much.

      You seem to be forgetting the very basis of your Hub. "Within all of these sciences dedicated to finding out how life came about, there are endless theories of our creation." The theories you brought up the time before had nothing to do with creation, nor do the theories you've since mentioned. In you Hub, you say that there are essentially two terrible theories of how existence came to be. Let me first say that niether of them are theories (also note: in spite of my "lack of scientific knowledge," I personally always consider the word "therory" to be scientific, my mistake?)

      "In one, we were not created by any God, we spurred out of nothing (or as part of an infinite loop). We don't know how our existence out of nothing came into being."

      This is NOT a scientific theory, neither is this: "In the other, we were created by God(s), explaining how we came to be. However, no explanation of how the God(s) were created are known."

      PLEASE, if nothing else, tell me a scientific theory of how existence came to be. Countless theories of our creation, or essentially two terrible ones?

    • LewSethics profile image

      LewSethics 5 years ago

      We don't know that atoms have a 'radioactive lifetime', that is just another theory.

      The infrared spectroscopy thing was cool, cuz you just made it up, haha. Planets orbit, round and round.

      It is galaxies that are (theoretically) expanding away from each other, not stars or planets. Even so, the only evidence for 'cosmic expansion' is the 'red shift' factor, which is also only a theory, and can be explained by distance/time lag on photons. Maybe photons redshift because they are losing some energy after flying through space for billions of years.

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @Steve,

      I see, please make sure you write what you mean the first time to avoid similar embarrassment in the future.

      As for your revised points then:

      "The Big Bang theory doesn't not explain the creation of the universe"

      "evolution explain the beginning of life"

      I agree.

      "Theories require scientific data, by definition." false. - Any definition of the word "theory" will include that whilst most accepted theories are based on repeated trials, it is not necessary for a theory to be based on such.

      Perhaps you meant scientific theory, and if you did, you would still be wrong. Ask if you don't understand.

      "Theories require scientific data, by definition. We have never (as far as I'm aware) created life." Yes we have. You haven't even searched that, if you did, you would see it comes up everywhere. It's naive to just say things Mr.Orion!

      "We don't know how life came to be. 0 theories on the matter."

      How can you say such disgustingly wrong things? You clearly haven't had any education in life sciences so I'll just refer you to "Abiogenis" which is the entire science of studying how inorganic molecules can become organic molecules.

      With the Miller-Urey experiment actually proving that it could have happened.

      There have been scientists who have devoted their entire lives working on the theories of life's creation such as Miller and Urey, rifting through endless streams of scientific data, just so people will end up saying "yeah, we have 0 theories on the matter."

      "We might speculate that there was some sort of chemical reaction millions or billions of years ago, but we have no theories on the matter. Do you contest this?"

      Mr.Steve I would be very much interested to know what your secrets of time travel are because with this sentence it is clear that you come from the 19th century.

      Not only do I contest this, but every scientist will contest this. Why are you arguing about things that you have clearly never even begun to study?

      Abiogensis, Pasteur, Darwin..

      3.8 billion years ago. Not millions of years ago, did life appear on Earth.

      Within all of these sciences dedicated to finding out how life came about, there are endless theories of our creation.

      What seems to be apparent now Mr.Steve, is when you said "we have 0 theories on our creation" you meant to say

      "I am uneducated in the sciences and as a result I know of 0 theories on our creation"

      There are free resources everywhere, why would you so naively just spew gibberish?

    • Steve Orion profile image

      Steve Orion 5 years ago from Tampa, Florida

      Ok, let me clear up any confusion here and make clear and concise points. There are no theories of the creation of the universe. Nor do we have theories of how life started here on Earth. The Big Bang theory doesn't not explain the creation of the universe, nor does evolution explain the beginning of life.

      Theories require scientific data, by definition. We have never (as far as I'm aware) created life. We don't know how life came to be. 0 theories on the matter. We might speculate that there was some sort of chemical reaction millions or billions of years ago, but we have no theories on the matter. Do you contest this?

      Concerning the universe, as in creation, in general, we have no theories on that matter either.

      As far as misquoting you goes, here is what I was addressing: "@Steve, just so you know, I would disagree with you that we have 0 theories 'scientifically' speaking, because I know that a lot of the modern theories of cosmology are based on data acquired, like Infrared spectroscopy which proves (or at least gives very strong evidence for) for example, that planets are moving away faster the further they are away from us. So, that being based on falsifiable data, I would say that there are endless theories of our creation."

      Emphasis on the last sentence! Not only are there not endless theories of our creation, but there are none! Unless you are speaking of evolution of nonhuman organisms into humans, our creation has no scientific theories to it. (So much for being concise haha)

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @Steve,

      "First off, in your Hub, you say we have only two theories and that they are both terrible. Which is it?"

      No Mr.Orion, I never said "we have only two theories and that they are both terrible." I said "essentially, we have two terrible theories of our creation."

      Which means, essentially (used to emphasize the basic, fundamental, or intrinsic nature of a someone or something) we have only two theories and they are both terrible.

      The use of the word "essentially" implies that I have simplified the theories of creation into two major groups, which is precisely what I did do.

      You cannot take my quotes out of context and then tell me I have contradicted myself.

      "Before you answer, let me say that all the theories you presented had to do with our evolution (NOT creation) or planets moving away from each other, or that the universe is expanding (NOT creation). The Big Bang certainly does not explain existence of matter and energy and time and space. It only states that there was a big bang a long time ago and that is why the universe is expanding. What does that say about how matter came to be?"

      But you did not ask for "creation" you asked for "our creation". Here you have taken your own words out of context and tried to make a different argument entirely. That said, both evolution and the big bang theory explain part of "our creation" because they both explain a way that humans came to be. That is what is implied with "our". I would not assume that by "our" you mean the entire universe, and all of it's matter, we are not the entire universe, we are humans.

      -------------------------------------------------

      '"I would disagree with you that we have 0 theories 'scientifically' speaking..."

      I said we have 0 scientific theories on our creation. Not 0 scientific theories, in general. Feel free to refer to my original post =)"

      Again you have taken only half of my sentence and tried to make a point of it, that's the StrawMan fallacy.

      My actual quote would have been:

      "I would disagree with you that we have 0 theories 'scientifically' speaking, because I know that a lot of the modern theories of cosmology" implies that the "theories" i mentioned were to do with the "cosmology" I followed it up with. You are not at liberty to argue particular words of my sentences, you must take the argument as a whole if you should expect similar gratitude.

      ""This is creation as in the creation of the Universe that ultimately lead to our creation."

      Yep. The Big Bang doesn't, to any extent, explain the CREATION of the universe and everything in it. That is an important distinction to make. Additionally, Darwin's Theory of Evolution states how organisms adapt to their environment and evolve through natural selection, not how they came to be and definitely not how the nonliving materials they are made of came to be."

      Yep. But a direct quote of what you said was "we have 0 theories on out "creation"" I can only assume that your typo there was OUR creation, and just as you affirm with your "yep", the big bang theory and evolution does explain OUR creation which is what YOU asked for? Do you understand where you are wrong in questioning me? The word "our" plays a part like all of the other words in a sentence. That is the distinction that needs to be made, between our creation, as humans, and the universe's creation. "We" are not the universe, so the possessive pronoun "our" does not include the universe.

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @Borsia,

      Just a few issues,

      "Just to make it clear to anyone who doesn’t understand Darwin’s theory of evolution I will point out that Darwin nor his theory ever tried to explain the origin of life, only the diversity of life through adaptation."

      Even if Darwin may not have intended it, (although I would argue that he did), his theory has given huge evidence towards the the origin of life, the modern view of our creation is based on his theory.

      As for great evidence against your claim, Darwin was the one who suggested that we all originated from a single simple ancestor. This may not be true as we know now today. But his saying that shows that he was very much keen on finding our origins. In his books like "Origin of Species" he attempts to bridge the gap between the first living creature and us now. I wouldn't say it's reasonable to say that Darwin or his theory didn't try to explain the origin of life, since that's precisely what it is doing. And since that's precisely why Darwin was abused by the theists who saw his theory as an attack on religion (which in essence it is).

      Even explaining "the diversity of life through adaptation" is an attempt at our origins, anything that works out how we changed from our ancestors is working backwards, in turn, towards our origin.

      "If you want to see the science I suggest watching Carl Sagan’s Life on Earth. As he points out if you set the clock to earth’s beginning life occurs in the last few seconds around 23:55 and humans in the last fleeting second. He follows the first living cells and simple algae and their evolution to the forms of life we see today"

      I'm not sure which one, but either you or Carl Sagan are mistaken. The Earth is around 4.5 Billion years old. The first signs of life happened 3.8 billion years ago. So 3.8/4.5 of the Earth's life was inhabited by life. That's 85% of the Earths age and would equate to 03:36 am on a 24 hour clock of our lives.

      (http://www.bbc.co.uk/nature/history_of_the_earth)

      And after that I agree entirely :)

      What I really want to know is why agnostics would side with theism instead of atheism, me and AntonOfTheNorth (who does so) are having a discussion right now about this topic. This is actually a comment I had sent him which explains the brevity of this hub! hah

      Thanks a lot for commenting Borsia, always a pleasure,

      Philanthropy,

    • Steve Orion profile image

      Steve Orion 5 years ago from Tampa, Florida

      I should have read Borsia's post before commenting, as she already responded to the Evolution point. Good job =)

    • Steve Orion profile image

      Steve Orion 5 years ago from Tampa, Florida

      "So, that being based on falsifiable data, I would say that there are endless theories of our creation."

      First off, in your Hub, you say we have only two theories and that they are both terrible. Which is it? Before you answer, let me say that all the theories you presented had to do with our evolution (NOT creation) or planets moving away from each other, or that the universe is expanding (NOT creation). The Big Bang certainly does not explain existence of matter and energy and time and space. It only states that there was a big bang a long time ago and that is why the universe is expanding. What does that say about how matter came to be?

      "I would disagree with you that we have 0 theories 'scientifically' speaking..."

      I said we have 0 scientific theories on our creation. Not 0 scientific theories, in general. Feel free to refer to my original post =)

      "This is creation as in the creation of the Universe that ultimately lead to our creation."

      Yep. The Big Bang doesn't, to any extent, explain the CREATION of the universe and everything in it. That is an important distinction to make. Additionally, Darwin's Theory of Evolution states how organisms adapt to their environment and evolve through natural selection, not how they came to be and definitely not how the nonliving materials they are made of came to be.

    • Borsia profile image

      Borsia 5 years ago from Currently, Philippines

      Just to make it clear to anyone who doesn’t understand Darwin’s theory of evolution I will point out that Darwin nor his theory ever tried to explain the origin of life, only the diversity of life through adaptation.

      If you want to see the science I suggest watching Carl Sagan’s Life on Earth. As he points out if you set the clock to earth’s beginning life occurs in the last few seconds around 23:55 and humans in the last fleeting second. He follows the first living cells and simple algae and their evolution to the forms of life we see today.

      As to the beginning of the universe it may well be that is has no beginning that we humans can comprehend as such. As mentioned we have no idea how many universes there might be or how they might interact. Today’s scientist claim that they can pinpoint the time of the Big Bang, but so what if they can. Something had to go bang so there has to be something leading up to the Big Bang.

      Theist have a great problem in that they want to have all of the answers to the origin of the universe, the earth and every form of life instantaneously. Of course most of what they believed in the past has been proven wrong.

      This they crave despite the fact that their answers starts somewhere in the middle and leaves more unanswered than answered. They just have a burning desire to fill in the blanks with fairytales rather than hard evidence.

      The key to understanding the scientific approach is that there is a key word. We don’t understand it all “YET”!

      While the theistic version of all things is locked in their stories the scientific version accepts that it is ever changing as we learn more and more.

      To me as an atheist I have to ask myself if it is more likely that the physical universe is a complex ever changing physical reality that we don’t quite yet grasp. Or it was all dreamt up by some omnipresent invisible and undetectable super being on a whim. A being with no more credible beginning than the Big Bang, and even less evidence.

      I then have to break that down into equations of probability. For me, and millions like me, the score goes to the ever advancing science. This leaves the concept of a god as the least probably, and for myself impossible.

    • profile image

      AntonOfTheNorth 5 years ago

      Hi philanthropy,

      As I just finished a longish response to this in my last hub, I'll only repeat that it is a good question. I hope you at least enjoy the answer. .)

      @ Steve Orion

      "Unless, of course, one of those hypothetical gods reveal themselves unto us, which I'd be very interested to see."

      The theists would respond: "wait for it. Everyone who ever lived meets the maker when they die" In that context, meeting god is not only frequent but inevitable.

      only if there is one, though. I'd like to see that too.

      But it might blow the whole purpose. :)

      cheers

    • Philanthropy2012 profile image
      Author

      DK 5 years ago from London

      @LewSethics,

      Nice name, and that's exactly what I mean, why complicate things.

      And yes as Steve is hinting at, all atoms seem to have a radioactive lifetime (we date things using half-lives) so eventually all atoms break down into their sub particles and re-form into new atoms, usually starting from hydrogen (alpha particles). This essentially determines how old any visible object can be, as if the atoms start breaking down of that object, it would seem it no longer exists.

      Unfortunately I agree, we know almost nothing for certain, but it's certainly within our nature to enjoy learning things, perhaps we would be bored if we knew everything.

      @Steve, just so you know, I would disagree with you that we have 0 theories 'scientifically' speaking, because I know that a lot of the modern theories of cosmology are based on data acquired, like Infrared spectroscopy which proves (or at least gives very strong evidence for) for example, that planets are moving away faster the further they are away from us. So, that being based on falsifiable data, I would say that there are endless theories of our creation.

      Also, sorry if this is embarrassing but "The Big Bang Theory", as the name suggests, is a great contradiction to your statement that we have no theories.

      This is creation as in the creation of the Universe that ultimately lead to our creation.

      And as for the tree of life, that is based on the theory of evolution. The theory being that we evolved from something else. 99.9% certainty is there on account of the vast amount of evidence both simple and molecular there.

      "Darwin's Theory of Evolution" is another prominent theory.

      Why would you say that we have no theories on our creation :L?

      What we don't have is absolute knowledge as to which theory is the correct one.

      Philanthropy,

    • Steve Orion profile image

      Steve Orion 5 years ago from Tampa, Florida

      "If the Universe is eternal then why aren't don't we find objects in space that are trillions of years old?"

      Because, from what I understand, things don't maintain their shape or form for that long. Not even stars or planets. Also, in a sense, everything is equally aged, as all the matter that is here has been here for all time, just simple (in a word) rearrangements of atoms.

    • Steve Orion profile image

      Steve Orion 5 years ago from Tampa, Florida

      Scientifically speaking, we have 0 theories on out "creation" other than speculation on when and how our tree of life began. Hell, there are even arguments that there are two or more trees of life here on Earth. Anyway, the question, "Why is there something rather than nothing?" might not ever be answered. Unless, of course, one of those hypothetical gods reveal themselves unto us, which I'd be very interested to see.

      The acceptance of our ignorance is certainly the only logical take on the whole matter, pun slightly intended.

    • LewSethics profile image

      LewSethics 5 years ago

      I don't know, but it seems to me that something has to be eternal.

      I always have trouble with people that insist that the Universe has to have a beginning, but then don't explain where the god that created the Universe came from. Something as complex as a creator-god with thoughts and emotions and the ability to make things happen couldn't just exist without some background. Then the question becomes 'where did that background come from?', so it goes on ad infinitum

      If the Universe is eternal then why aren't don't we find objects in space that are trillions of years old?

      Quadrillions? Where are all the really old things?

      (We are assuming that the science we are using for our numbers is somewhere in the ballpark.)

      The Multiverse Foam Theory, in which our Universe is only a bubble in a Multiverse Foam, where universes pop in and out of existence only begs the question 'where did the foam come from', so that doesn't really do anything except make the problem bigger and makes humans seem even more inconsequential than just being a teeny planet in our own universe.

      Maybe some middle ground. Maybe keep a Spiritual Dimension but lose the gods. Maybe the Speed of Light, or some other physics constant, isn't a constant, and needs rethunk.

      But in spite of all the vagueness about the origin of it all, all we really know is that the NOW exists, and we don't even know what the hell that is.