its all there, just work for it [clothes +]

1. 37

   Danie Van Gilderposted 14 years ago

   we have to work to make our clothing, homes and food,  such IS stored in nature as: sheep, cotton, then rocks and stones and wood, and vegetables.  tehy are all there, we just need to go out there and harvest them, work to get them, like:
            sewing    wool cotton
            homes     rocks and trees
            food      vegetabels and fruit and nuts
       this proves there is a God, for he planned it to be that way.  then gasoline from oil and some say, too,:
          marrijuanna and peyote and mushrooms?  like beer and wine inclueded too?

   replyreport
   1. 0

      Home Girlposted 14 years agoin reply to this

      Did he tell you personally about his plans?

      replyreport
   2. 60

      Stimpposted 14 years agoin reply to this

      Okay....I think we already do this?  What's your point.

      replyreport
   3. 60

      Disappearingheadposted 14 years agoin reply to this

      God gave us beer and wine because He wantd us to b happy.

      replyreport
2. 89

   I am DB Cooperposted 14 years ago

   Hmmm, I'm not too sure this is a proof of God. If people evolved from simpler living organisms that evolved from self-replicating semi-permeable membranes that were created through a spontaneous chemical process we also get our current world filled with a variety of species and it's all done without a creator. The theory of evolution makes it nearly impossible for humans to exist without the existence of other living species. That's just how evolution works. A change in a subset of a species that can be passed down from generation to generation does not need to kill off the original species, especially if they have been separated and are in different ecosystems. Species evolve based on their environment. Whatever changes that help them be more sexually productive are the changes that survive. We would have never been able to evolve into humans if the animals we evolved from did not have edible food. That doesn't necessarily mean that there was a God creating this food for us.

   replyreport
   1. 37

      Danie Van Gilderposted 14 years agoin reply to this

      have you known that by ONLY, usualy, three different chemicals make up all life forms?  (Carbon, Hydrogen and Oxygen) and that only, mostly three (four too?) DNA type chemicals make up all the different personalities of man, just out of three chemicals, all of life is from by, so that that was started somehow, liike a game of pool, with balls and sticks, so that, so many different games could actually play, one started wioth only three chemicals and three dna strands, and got billions of different life from thadt only three different chemicals.
          so, in meaning = on different planets, they would use more different chemicals!  than ours.  c h o  and   t a g c   so that by those only, all of OUR life is made from, generaly very simple..  how many combinations of, say, three letters can you come up with?   choo ohcc hhhoochoo coo hoc c????  well, that's life (yours?) simple, very very...  i guess you were smarter than others, eh?     ttattggaattaaggataggttatagga??? that's your left wallet the bank took from you to make more from/by your money!!!

      replyreport